Tap only the frog of the specified color and compete for the fastest time. Be careful not to be tricked by mismatched cues, such as the word “green” written in red. This game trains your attention, judgment, and concentration all at once. With online rankings, you can compete with your friends! - More info on FrogGrabber...

Keep a safe distance and enjoy rock-paper-scissors with nearby friends! This app lets you play 1-on-1 rock-paper-scissors with friends nearby using Wi-Fi and Bluetooth. Just tap the screen to connect—no need to bring your devices close together, so you can play both indoors and outdoors! How to Play 1. Launch the app with your friend 2. Tap “Search” to find your opponent 3. Select the devi... - More info on P2P RPS...

Want to say something, but also… not really? This app lets you hide those feelings inside ATCG. If saying “thank you” directly feels awkward, or being honest feels too embarrassing, just convert your message into a DNA-style ATCG sequence with this app. ■Text → Nucleotide Sequence “Thank you” becomes something like TTTATCCATCATTCGCTCCGACAATGCTTCGGTGTT unnecessarily long and mysteri... - More info on DNAConverter...

This is a map app that lets you record your memories of traveling across the Kansai region, city by city. You can save photos and notes for all 43 municipalities in Osaka Prefecture. As you mark the places you’ve visited, the map fills with color—creating a completion map where your progress is easy to see at a glance. ■ Main Features ・Record visits for each municipality (with photos and... - More info on KansaiMap...

This app lets you record your travels across all 47 prefectures of Japan with photos and notes. As you mark the prefectures you’ve visited, the map fills with color—making your progress toward complete Japan travel visible at a glance. Save all your trip photos and notes in one place and create your own travel album that brings back memories whenever you look back. ■ Main Features ・Regis... - More info on 47 Moments...

Have Fun Training Your Brain with the 100-Masu Calculation App! A simple yet profound app that everyone can enjoy! Improve your calculation skills while customizing your experience to match your style. ■Flexible Calculation Modes Supports addition, subtraction, and multiplication from single-digit to double-digit numbers. Choose your preferred difficulty, from 25 to 100 grids! ■Compete on th... - More info on Fast100Math...

Make decisions instantly—anytime, anywhere! A decision-making app packed with dice, coins, and a roulette wheel. When you're unsure, leave it to this app. Perfect for shopping choices, meals, outings, picking turns in games, and solving everyday indecision in a fun way. ■ Dice (1–3) Great for “testing your luck,” “choosing order,” or quick decisions! ■ Coin Toss (1–3 coins) Fo... - More info on DiceLife...

Live your double life as a student and Phantom Thief in P5X! Make the most of being a high schooler in Tokyo by hitting the bustling streets of Shibuya, Shinjuku and Kichijoji. Once the bell rings, don the mask of a Phantom Thief and infiltrate the hidden realm of the Metaverse to take on the dark beings that lie within... Live It Up in the Big City as a Student During the Day! How you spend you... - More info on P5X | Persona5: The ...