Price: $ 0.99 USD - $0.99
Genre: Utilities
Developer: makoto amijima }else{?>Developer: makoto amijima
Rated: 0 out of 5 stars.
Based on 0 reviews.
Shop Collectibles and Memorabilia.
Apple AppStore - Google Play
DNAConverter App V. 2.0.0
by makoto amijima
Want to say something, but also… not really? This app lets you hide those feelings inside ATCG. If saying “thank you” directly feels awkward, or being honest feels too embarrassing, just conver - More Info...
New Music Discovery with PlaylistDuel.com
AMAZON EBAY WALMART
BESTBUY ETSY
Huge Collectibles - Preorders Bestseller Gifts Shop Disney Collectibles
Top Gifts and Preorders Entertainment Earth SideShow Collectibles
❯ Top Gifts and Preorders.
🌟 What makes DNAConverter so special? 🌟
Want to say something, but also… not really? This app lets you hide those feelings inside ATCG. If saying “thank you” directly feels awkward, or being honest feels too embarrassing, just convert your message into a DNA-style ATCG sequence with this app. ■Text → Nucleotide Sequence “Thank you” becomes something like TTTATCCATCATTCGCT...
Whether you're a seasoned pro or a newbie in the digital world, DNAConverter app is designed to make your life easier, more fun, and more productive. Here are just a few highlights:
share
🚀 Price: 0.99 USD
📈 Rating: 0 out of 5 stars. Based on 0 total reviews.
🎨 Content Rating: 4+
💡 New Features:
But that's not all! The makoto amijima team is continuously improving and expanding DNAConverter to bring you even more exciting features at the palm of your hand, being last updated at 2025-11-19, the makoto amijima team works hard to stay ahead of the curve and bring you an exceptionally robust, secure, and up-to-date app.
Download and experience DNAConverter now and unlock a new journey in your mobile world – Your mobile device will thank you.! 📱💫
Also don't miss out on future mobile app features. Join the millions who have already discovered the magic of DNAConverter and download BigTopApps Discovery App today, and never miss a new app announcement and feature release again! We are also on the web at BigTopApps.com.
Apple AppStore - Google Play
Shop Collectibles and Memorabilia.
BestBuy - WalMart - Entertainment Earth
Developer: makoto amijima
Seller: makoto amijima
Price: 0.99 USD
Current version: 2.0.0
Last Updated: 2025-11-19
Ratings: 0 out of 5 stars.
Based on 0 reviews. (Rate/Review)
Genre: Utilities
Filesize: 1.27MB
IOS Bundle ID: am10.DNAConverter
Age Rating: 4+
Languages: AR, EN, FR, ID, JA, MS, PT, RU, ES, ZH
Videos: DNAConverter App Videos
Apple AppStore - Google Play
Please note BigTopApps is not responsible for the content provided by the publicly accessible App Store API.
This app lets you hide those feelings inside ATCG.
If saying “thank you” directly feels awkward, or being honest feels too embarrassing, just convert your message into a DNA-style ATCG sequence with this app.
■Text → Nucleotide Sequence
“Thank you” becomes something like TTTATCCATCATTCGCTCCGACAATGCTTCGGTGTT unnecessarily long and mysteriously meaningful!
Send it to someone and they won’t understand a thing, but you can feel satisfied that you “expressed your gratitude.”
■Nucleotide Sequence → Text
Even ATCG-only cryptic messages can be decoded back to the original text.
Perfect for private “secret code” chats among friends.
■Features
• Generates DNA-like sequences instantly, even though they mean nothing
• Copy & paste into messaging apps for quick sharing
• Decode mode for conversations only insiders can understand
• Absolutely no biological meaning whatsoever
Even the words you can’t say out loud might feel lighter when you hide them in ATCG.
Apple AppStore - Google Play
Leave feedback and review DNAConverter
BIGTOPAPPS
Contact US for Reviews.
THESHOPCHANNEL APP - Best Shopping Deals, Coupons, and Savings!
Mini Games Studio on iOS and Android.
Casting ATL, FREE on iOS and Google Play Store!
Apple TV MLS Season Pass Apple TV + Apple Music Free 3 Months
© 2026 BigTopApps -
Privacy Policy - Troubleshooting Guide - Directory - Contact Us
LiveDataLink Development.
Please note BigTopApps is not responsible for the content provided by the publicly accessible App Store API.
The BigTopApps, BigTopApps.com, and all connected websites, social media platforms, and media outlets are part of a professional website network.
Please note that we may receive compensation from various entities whose products and services we review, promote, and/or endorse.
We are independently owned and the opinions expressed here are our own, except where indicated.