material.indigo-light_blue.min
DNAConverter App
bigtopaps logo

Application Development, Design, SEO, ASO, Marketing.
Shop Collectibles and Memorabilia.




Free Apps Paid Apps
share
DNAConverter App
Price: $ 0.99 USD - $0.99
Genre: Utilities
Developer: makoto amijima Developer: makoto amijima

Rated: 0 out of 5 stars.
Based on 0 reviews.
Shop Collectibles and Memorabilia.
Details Description Screenshots Updates
❯ The DNAConverter App Review from the BigTopApps Team.
Introducing DNAConverter, the mobile app that has been shaking up the Utilities genre since 2020-01-11! With an astonishing 0 out of 5 stars on average, people can't stop raving about the incredible features and experiences the app offers. All built by the incredible team at makoto amijima.

🌟 What makes DNAConverter so special? 🌟

Want to say something, but also… not really? This app lets you hide those feelings inside ATCG. If saying “thank you” directly feels awkward, or being honest feels too embarrassing, just convert your message into a DNA-style ATCG sequence with this app. ■Text → Nucleotide Sequence “Thank you” becomes something like TTTATCCATCATTCGCT...

Whether you're a seasoned pro or a newbie in the digital world, DNAConverter app is designed to make your life easier, more fun, and more productive. Here are just a few highlights:
DNAConverter App Screenshots

share

🚀 Price: 0.99 USD
📈 Rating: 0 out of 5 stars. Based on 0 total reviews.
🎨 Content Rating: 4+
💡 New Features:
App design refreshed!

But that's not all! The makoto amijima team is continuously improving and expanding DNAConverter to bring you even more exciting features at the palm of your hand, being last updated at 2025-11-19, the makoto amijima team works hard to stay ahead of the curve and bring you an exceptionally robust, secure, and up-to-date app.

Download and experience DNAConverter now and unlock a new journey in your mobile world – Your mobile device will thank you.! 📱💫

Also don't miss out on future mobile app features. Join the millions who have already discovered the magic of DNAConverter and download BigTopApps Discovery App today, and never miss a new app announcement and feature release again! We are also on the web at BigTopApps.com.
Download DNAConverter App
Apple AppStore - Google Play
Shop Collectibles and Memorabilia.
BestBuy - WalMart - Entertainment Earth
DNAConverter App Details
Available Since: 2020-01-11
Developer: makoto amijima
Seller: makoto amijima
Price: 0.99 USD
Current version: 2.0.0
Last Updated: 2025-11-19

Ratings: 0 out of 5 stars.
Based on 0 reviews. (Rate/Review)
Genre: Utilities
Filesize: 1.27MB
IOS Bundle ID: am10.DNAConverter
Age Rating: 4+
Languages: AR, EN, FR, ID, JA, MS, PT, RU, ES, ZH

Videos: DNAConverter App Videos
Shop Collectibles and Memorabilia.
Download DNAConverter App
Apple AppStore - Google Play

DNAConverter Updates and Release Notes
App design refreshed!
This data was collected from public app stores.
Please note BigTopApps is not responsible for the content provided by the publicly accessible App Store API.
❯ DNAConverter App Description
DNAConverter App Icon
DNAConverter Apple Appstore App Download Button
DNAConverter Google Play App Download Button

Want to say something, but also… not really?
This app lets you hide those feelings inside ATCG.

If saying “thank you” directly feels awkward, or being honest feels too embarrassing, just convert your message into a DNA-style ATCG sequence with this app.

■Text → Nucleotide Sequence
“Thank you” becomes something like TTTATCCATCATTCGCTCCGACAATGCTTCGGTGTT unnecessarily long and mysteriously meaningful!

Send it to someone and they won’t understand a thing, but you can feel satisfied that you “expressed your gratitude.”

■Nucleotide Sequence → Text
Even ATCG-only cryptic messages can be decoded back to the original text.
Perfect for private “secret code” chats among friends.

■Features
• Generates DNA-like sequences instantly, even though they mean nothing
• Copy & paste into messaging apps for quick sharing
• Decode mode for conversations only insiders can understand
• Absolutely no biological meaning whatsoever

Even the words you can’t say out loud might feel lighter when you hide them in ATCG.

Download DNAConverter App
Apple AppStore - Google Play




Apple TV MLS Season Pass Apple TV + Apple Music Free 3 Months
Discussions, Ratings, and Reviews for DNAConverter App

Leave feedback and review DNAConverter

Updates, News, and Referral Code Requests.
Top Deals
Todays Top Electronics Deals
NEWSLETTER

Want BIG updates? Subscribe Here:


share
Featured: Business Solutions
Top Free Apps
ChatGPT - OpenAI OpCo, LLC
1
Introducing ChatGPT for iOS: OpenAI’s latest advancements at your fingertips. This official app is free, syncs your history across devices, and brings you the latest from OpenAI, includi...
Threads - Instagram, Inc.
2
Say more with Threads — Instagram’s text-based conversation app. Threads is where communities come together to discuss everything from the topics you care about today to what’ll be trend...
Paramount+ - CBS Interactive
3
Stream exclusive originals, hit movies, live sports like NFL on CBS and UEFA Champions League, all of SHOWTIME® (Premium plan only), and favorites from CBS, Nickelodeon, Comedy Central, B...
UpScrolled - RECURSIVE METHODS PTY LTD
4
UpScrolled — Where voices connect, stories unfold, and expression thrives. Built for authentic connection and genuine expression. Unlike mainstream platforms, UpScrolled prioritizes real...
Google Gemini - Google
5
Google Gemini app is your personal, proactive and powerful AI Assistant. With Gemini on your iPhone or iPad, you can: - Enjoy fast and unlimited prompting powered by our biggest upgrade...
Temu: Shop Like a Billionaire - Temu
6
Shop on Temu for exclusive offers. No matter what you're looking for, Temu has you covered, including fashion, home decor, handmade crafts, beauty & cosmetics, clothing, shoes, and more...
Top Paid Apps
Minecraft: Dream it, Build it! - Mojang
1
Dive into an open world of building, crafting and survival. Gather resources, survive the night, and build whatever you can imagine one block at a time. Explore and craft your way through...
Geometry Dash - RobTop Games AB
2
Jump and fly your way through danger in this rhythm-based action platformer! "Frustratingly wonderful" - Kotaku "Geometry Dash provides all of the challenge expected from an “impossibl...
Heads Up! - Warner Bros.
3
It's the game The New York Times called a "Sensation!" and Cosmopolitan raved “Your existence is dull and meaningless without this life-changing app!” Get ready for endless fun with Head...
Plague Inc. - Ndemic Creations
4
Can you infect the world? Plague Inc. is a unique mix of high strategy and terrifyingly realistic simulation. Your pathogen has just infected 'Patient Zero'. Now you must bring about th...
MONOPOLY: The Board Game - Marmalade Game Studio
5
Play MONOPOLY on the go without distractions – no ads, no fuss! Challenge friends, family and fans from around the globe in the digital version of the official MONOPOLY board game, lice...
Bloons TD 6 - Ninja Kiwi
6
Craft your perfect defense from a combination of powerful Monkey Towers and awesome Heroes, then pop every last invading Bloon! Over a decade of tower defense pedigree and regular massiv...
Top Grossing Apps
ChatGPT - OpenAI OpCo, LLC
1
Introducing ChatGPT for iOS: OpenAI’s latest advancements at your fingertips. This official app is free, syncs your history across devices, and brings you the latest from OpenAI, includi...
YouTube - Google
2
Get the official YouTube app on iPhones and iPads. See what the world is watching -- from the hottest music videos to what’s popular in gaming, fashion, beauty, news, learning and more. S...
MONOPOLY GO! - Scopely, Inc.
3
The wizarding world awaits! Hit GO! Roll the dice with the witches and wizards of Harry Potter! Earn MONOPOLY money, interact with your friends, family members and fellow Tycoons from aro...
TikTok - Videos, Shop & LIVE - TikTok Ltd.
4
TikTok is THE destination for mobile videos. On TikTok, short-form videos are exciting, spontaneous, and genuine. Whether you’re a sports fanatic, a pet enthusiast, or just looking for a ...
Paramount+ - CBS Interactive
5
Stream exclusive originals, hit movies, live sports like NFL on CBS and UEFA Champions League, all of SHOWTIME® (Premium plan only), and favorites from CBS, Nickelodeon, Comedy Central, B...
Royal Match - Dream Games
6
King Robert needs your help to restore Royal Castle’s former glory. Break the obstacles and combine amazing power-ups to beat joyful and challenging levels! Keep unlocking wonderful areas...

© 2026 BigTopApps -
Privacy Policy - Troubleshooting Guide - Directory - Contact Us
LiveDataLink Development.

This data was collected from public app stores.
Please note BigTopApps is not responsible for the content provided by the publicly accessible App Store API.

Affiliate Disclosure Disclaimer
The BigTopApps, BigTopApps.com, and all connected websites, social media platforms, and media outlets are part of a professional website network.
Please note that we may receive compensation from various entities whose products and services we review, promote, and/or endorse.
We are independently owned and the opinions expressed here are our own, except where indicated.